|
Left Crispr |
Right Crispr |
| Crispr ID |
1127454682 |
1127454686 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:59146018-59146040
|
15:59146048-59146070
|
| Sequence |
CCTTATTGTTATTATTTTTAGAG |
CTTGCTATGATGCCCAGGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 1, 2: 29, 3: 113, 4: 1115} |
{0: 2, 1: 110, 2: 856, 3: 1986, 4: 4055} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|