ID: 1127456199_1127456208

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1127456199 1127456208
Species Human (GRCh38) Human (GRCh38)
Location 15:59158259-59158281 15:59158278-59158300
Sequence CCCAGACTACGGTACGTAGCTGG CTGGCTTACCTGGGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15} {0: 1, 1: 0, 2: 4, 3: 44, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!