ID: 1127474603_1127474606

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1127474603 1127474606
Species Human (GRCh38) Human (GRCh38)
Location 15:59321658-59321680 15:59321672-59321694
Sequence CCAATAGACATGGGGACTACTAG GACTACTAGAGGCAGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50} {0: 2, 1: 18, 2: 64, 3: 199, 4: 865}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!