ID: 1127483165_1127483173

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1127483165 1127483173
Species Human (GRCh38) Human (GRCh38)
Location 15:59395836-59395858 15:59395873-59395895
Sequence CCCTCCCCCTTTCTCCTAGTCAG TTTCCCCCAAATCCAAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 407} {0: 1, 1: 0, 2: 2, 3: 23, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!