ID: 1127483167_1127483174

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1127483167 1127483174
Species Human (GRCh38) Human (GRCh38)
Location 15:59395840-59395862 15:59395874-59395896
Sequence CCCCCTTTCTCCTAGTCAGCCTG TTCCCCCAAATCCAAAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 283} {0: 1, 1: 0, 2: 2, 3: 22, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!