ID: 1127483171_1127483174

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1127483171 1127483174
Species Human (GRCh38) Human (GRCh38)
Location 15:59395850-59395872 15:59395874-59395896
Sequence CCTAGTCAGCCTGTGCGATATAA TTCCCCCAAATCCAAAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} {0: 1, 1: 0, 2: 2, 3: 22, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!