ID: 1127487437_1127487442

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1127487437 1127487442
Species Human (GRCh38) Human (GRCh38)
Location 15:59432358-59432380 15:59432404-59432426
Sequence CCCTCAAAATAAATTTTTATAAG GTGCTGTCCTTGGGGAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 141, 4: 1158} {0: 1, 1: 0, 2: 0, 3: 21, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!