ID: 1127505797_1127505802

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1127505797 1127505802
Species Human (GRCh38) Human (GRCh38)
Location 15:59596587-59596609 15:59596608-59596630
Sequence CCTTCCACCTACTAAAGGTTTGC GCGGATGATGAGCTGACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155} {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!