|
Left Crispr |
Right Crispr |
| Crispr ID |
1127509756 |
1127509757 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:59628915-59628937
|
15:59628955-59628977
|
| Sequence |
CCATTGAAGTTTTTTTTTTTTTG |
TGAGTCTCACTCTAACAGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 236, 3: 2210, 4: 16588} |
{0: 1, 1: 2, 2: 74, 3: 2019, 4: 29817} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|