ID: 1127530132_1127530136

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1127530132 1127530136
Species Human (GRCh38) Human (GRCh38)
Location 15:59835570-59835592 15:59835593-59835615
Sequence CCCCTCTCACTGGGTCTTGCTTT CTCCATCTACAGAATGACCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!