ID: 1127578902_1127578905

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1127578902 1127578905
Species Human (GRCh38) Human (GRCh38)
Location 15:60318829-60318851 15:60318876-60318898
Sequence CCCACCATTAGAGTTGAAAGCTG ATTAACACCCGATTTTAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!