ID: 1127588323_1127588339

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1127588323 1127588339
Species Human (GRCh38) Human (GRCh38)
Location 15:60398161-60398183 15:60398212-60398234
Sequence CCGCGCCACGCGGGAGCGGCCCC GCCCGGCCGAGGCTGCCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 218} {0: 1, 1: 0, 2: 4, 3: 44, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!