ID: 1127613028_1127613031

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1127613028 1127613031
Species Human (GRCh38) Human (GRCh38)
Location 15:60655669-60655691 15:60655708-60655730
Sequence CCTTCTCTGTCTCTTTGGATGTT TACTCATACCTGCTGAAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 108, 3: 6748, 4: 3406} {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!