ID: 1127614416_1127614418

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1127614416 1127614418
Species Human (GRCh38) Human (GRCh38)
Location 15:60669559-60669581 15:60669585-60669607
Sequence CCACATTGGTTATGAGAGAAAGC AACCTGCTCTCTGTTCTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 148} {0: 1, 1: 0, 2: 2, 3: 14, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!