ID: 1127643800_1127643804

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1127643800 1127643804
Species Human (GRCh38) Human (GRCh38)
Location 15:60940094-60940116 15:60940122-60940144
Sequence CCTCCAACCCTATCAGCATTTTT ATGTTTCACTCTAATAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 290} {0: 1, 1: 0, 2: 1, 3: 19, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!