ID: 1127650171_1127650174

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1127650171 1127650174
Species Human (GRCh38) Human (GRCh38)
Location 15:60999294-60999316 15:60999316-60999338
Sequence CCAGGCTCCATTTGAACATGGGG GTTCTCAAAAGAACAGTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124} {0: 1, 1: 0, 2: 2, 3: 23, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!