ID: 1127653946_1127653948

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1127653946 1127653948
Species Human (GRCh38) Human (GRCh38)
Location 15:61037780-61037802 15:61037793-61037815
Sequence CCTGAGATGAATGCTATAATAGA CTATAATAGAAGATGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144} {0: 1, 1: 1, 2: 4, 3: 29, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!