ID: 1127668412_1127668419

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1127668412 1127668419
Species Human (GRCh38) Human (GRCh38)
Location 15:61171403-61171425 15:61171453-61171475
Sequence CCCCCAGAGTTCAGTAGGTCTGT GATGCTGATTCTGCTAATCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 131} {0: 1, 1: 1, 2: 25, 3: 221, 4: 692}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!