ID: 1127670228_1127670238

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1127670228 1127670238
Species Human (GRCh38) Human (GRCh38)
Location 15:61187941-61187963 15:61187971-61187993
Sequence CCCTCAACCCTCCCCTAACACAC CTCCCTGCCTCAGACCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 402} {0: 1, 1: 0, 2: 7, 3: 83, 4: 536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!