ID: 1127679381_1127679385

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1127679381 1127679385
Species Human (GRCh38) Human (GRCh38)
Location 15:61277996-61278018 15:61278017-61278039
Sequence CCTCCCAAAATGTTGAGATTACA CAGGCCTGAGCCACCGCGCCCGG
Strand - +
Off-target summary {0: 155, 1: 4541, 2: 58513, 3: 354081, 4: 252051} {0: 491, 1: 34132, 2: 89308, 3: 152461, 4: 169741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!