ID: 1127679381_1127679388

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1127679381 1127679388
Species Human (GRCh38) Human (GRCh38)
Location 15:61277996-61278018 15:61278028-61278050
Sequence CCTCCCAAAATGTTGAGATTACA CACCGCGCCCGGCTTACCATTGG
Strand - +
Off-target summary {0: 155, 1: 4541, 2: 58513, 3: 354081, 4: 252051} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!