ID: 1127722936_1127722939

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1127722936 1127722939
Species Human (GRCh38) Human (GRCh38)
Location 15:61720562-61720584 15:61720575-61720597
Sequence CCTCTTGTCAGCCAGCCCGACAA AGCCCGACAATCACCTTCGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!