|
Left Crispr |
Right Crispr |
| Crispr ID |
1127739842 |
1127739844 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:61892245-61892267
|
15:61892261-61892283
|
| Sequence |
CCTATTCAGAGTGGCTGTTCAGC |
GTTCAGCAGCACAACACTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 25, 2: 69, 3: 64, 4: 149} |
{0: 1, 1: 8, 2: 26, 3: 46, 4: 167} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|