ID: 1127753529_1127753544

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1127753529 1127753544
Species Human (GRCh38) Human (GRCh38)
Location 15:62068303-62068325 15:62068342-62068364
Sequence CCCGCCGTCGTCCCGGGTCCCGT GGCCGAGGGCACCGTGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 49} {0: 1, 1: 1, 2: 2, 3: 24, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!