ID: 1127753530_1127753534

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1127753530 1127753534
Species Human (GRCh38) Human (GRCh38)
Location 15:62068304-62068326 15:62068318-62068340
Sequence CCGCCGTCGTCCCGGGTCCCGTT GGTCCCGTTTCCCGAGCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40} {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!