ID: 1127753675_1127753679

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1127753675 1127753679
Species Human (GRCh38) Human (GRCh38)
Location 15:62068940-62068962 15:62068966-62068988
Sequence CCCAATATAGACAGCCATTTGCA CATATGTACCACACACGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167} {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!