ID: 1127773069_1127773073

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1127773069 1127773073
Species Human (GRCh38) Human (GRCh38)
Location 15:62245855-62245877 15:62245871-62245893
Sequence CCTCTTGCTCCAGCAACCTCTTC CCTCTTCCTGCTCTTGGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 3, 3: 38, 4: 473} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!