ID: 1127773114_1127773118

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1127773114 1127773118
Species Human (GRCh38) Human (GRCh38)
Location 15:62246133-62246155 15:62246170-62246192
Sequence CCAACAACCTCTCGTCTTGTTCC CCTCTTCCTGCTCTTCGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134} {0: 1, 1: 2, 2: 4, 3: 28, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!