ID: 1127806566_1127806578

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1127806566 1127806578
Species Human (GRCh38) Human (GRCh38)
Location 15:62526511-62526533 15:62526553-62526575
Sequence CCAGCACTGTGAGCCAATCCAGG GGTTAGTTACAGTCATCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 233} {0: 1, 1: 0, 2: 1, 3: 6, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!