ID: 1127869549_1127869560

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1127869549 1127869560
Species Human (GRCh38) Human (GRCh38)
Location 15:63059909-63059931 15:63059939-63059961
Sequence CCAAAACTCCTCTCCCCCAGCCA CCGGACAAAAGATCTTTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 525} {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!