ID: 1127878741_1127878743

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1127878741 1127878743
Species Human (GRCh38) Human (GRCh38)
Location 15:63136546-63136568 15:63136584-63136606
Sequence CCTAGGAAAATGTTTTGTCTGTT ATTTGATACAGTATCTATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 591} {0: 1, 1: 1, 2: 4, 3: 29, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!