ID: 1127890206_1127890217

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1127890206 1127890217
Species Human (GRCh38) Human (GRCh38)
Location 15:63243649-63243671 15:63243684-63243706
Sequence CCAGGTCCCATCCTTGACTAATT CAGAATTTGGGGAAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 433} {0: 1, 1: 0, 2: 5, 3: 43, 4: 589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!