ID: 1127899512_1127899513

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1127899512 1127899513
Species Human (GRCh38) Human (GRCh38)
Location 15:63330602-63330624 15:63330616-63330638
Sequence CCAGTCTGTGGCTGGTGGGGGTA GTGGGGGTACCCTTCATGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 219} {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!