|
Left Crispr |
Right Crispr |
| Crispr ID |
1127902914 |
1127902928 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:63354470-63354492
|
15:63354513-63354535
|
| Sequence |
CCCCCAAATCTCCCCTTGGGGAG |
CAGGAGTTTGAGACAAGCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 25, 4: 574} |
{0: 544, 1: 21733, 2: 41632, 3: 58462, 4: 49708} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|