|
Left Crispr |
Right Crispr |
| Crispr ID |
1127926174 |
1127926184 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:63545690-63545712
|
15:63545728-63545750
|
| Sequence |
CCAGGCACGGTAGCTCACAACTG |
GGGAGGCTAAGGCGGGCGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 219, 2: 7371, 3: 40115, 4: 106206} |
{0: 1, 1: 37, 2: 664, 3: 7999, 4: 73484} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|