ID: 1127932940_1127932948

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1127932940 1127932948
Species Human (GRCh38) Human (GRCh38)
Location 15:63609406-63609428 15:63609435-63609457
Sequence CCAGATAGAATGAGCTGAGGCCC CCCGTGGCCCTCGAGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 111} {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!