ID: 1127935749_1127935754

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1127935749 1127935754
Species Human (GRCh38) Human (GRCh38)
Location 15:63636049-63636071 15:63636066-63636088
Sequence CCATCTCCCCAGCTAAAGACCTC GACCTCACCACTTTCAGTTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 258} {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!