ID: 1127952371_1127952373

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1127952371 1127952373
Species Human (GRCh38) Human (GRCh38)
Location 15:63821862-63821884 15:63821879-63821901
Sequence CCAAGGTTCCTGCTTTCATGGAG ATGGAGTTTACATTCTAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 40, 4: 270} {0: 1, 1: 35, 2: 164, 3: 684, 4: 1672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!