ID: 1127965835_1127965836

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1127965835 1127965836
Species Human (GRCh38) Human (GRCh38)
Location 15:63922406-63922428 15:63922420-63922442
Sequence CCTTCATCACAAATCAATTCTCA CAATTCTCAAGCATTTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 307} {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!