ID: 1127965844_1127965854

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1127965844 1127965854
Species Human (GRCh38) Human (GRCh38)
Location 15:63922448-63922470 15:63922490-63922512
Sequence CCATCCTCCCTCTGCAGAAGGGG CTCTAATTGTTTTAACAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 447} {0: 1, 1: 0, 2: 1, 3: 14, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!