ID: 1127975050_1127975062

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1127975050 1127975062
Species Human (GRCh38) Human (GRCh38)
Location 15:63990934-63990956 15:63990962-63990984
Sequence CCCCCTCCCTACTCCTCTGCCTG GCTCCACTGTGGAGCCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 151, 4: 1218} {0: 1, 1: 0, 2: 3, 3: 27, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!