ID: 1127975492_1127975496

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1127975492 1127975496
Species Human (GRCh38) Human (GRCh38)
Location 15:63994018-63994040 15:63994047-63994069
Sequence CCAGGGCTTCAGGCAAGGAGAGC CAGGGACTATCTTCATGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 233} {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!