ID: 1127982698_1127982704

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1127982698 1127982704
Species Human (GRCh38) Human (GRCh38)
Location 15:64046315-64046337 15:64046331-64046353
Sequence CCGCGGTCGCGGCCGCGGCAGGC GGCAGGCGCGGCGGGAGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 209} {0: 1, 1: 3, 2: 22, 3: 177, 4: 1216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!