ID: 1127982698_1127982705

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1127982698 1127982705
Species Human (GRCh38) Human (GRCh38)
Location 15:64046315-64046337 15:64046332-64046354
Sequence CCGCGGTCGCGGCCGCGGCAGGC GCAGGCGCGGCGGGAGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 209} {0: 1, 1: 1, 2: 18, 3: 122, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!