|
Left Crispr |
Right Crispr |
| Crispr ID |
1127982702 |
1127982711 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:64046327-64046349
|
15:64046350-64046372
|
| Sequence |
CCGCGGCAGGCGCGGCGGGAGCG |
GCGGGCGCGGCGGGCGCGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 1, 3: 23, 4: 237} |
{0: 6, 1: 9, 2: 60, 3: 294, 4: 1721} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|