ID: 1127982702_1127982717

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1127982702 1127982717
Species Human (GRCh38) Human (GRCh38)
Location 15:64046327-64046349 15:64046368-64046390
Sequence CCGCGGCAGGCGCGGCGGGAGCG GCGGGCGCGGCGGGCGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 237} {0: 6, 1: 9, 2: 60, 3: 294, 4: 1721}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!