ID: 1127988744_1127988761

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1127988744 1127988761
Species Human (GRCh38) Human (GRCh38)
Location 15:64095851-64095873 15:64095887-64095909
Sequence CCGCCCCGCCCCCAGCGCCTAAG TCTCCGCCCCTCGGATCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 412} {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!