ID: 1127988744_1127988768

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1127988744 1127988768
Species Human (GRCh38) Human (GRCh38)
Location 15:64095851-64095873 15:64095899-64095921
Sequence CCGCCCCGCCCCCAGCGCCTAAG GGATCCCACGGGGTCCCTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 412} {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!