ID: 1127996913_1127996919

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1127996913 1127996919
Species Human (GRCh38) Human (GRCh38)
Location 15:64158515-64158537 15:64158530-64158552
Sequence CCCCCAGCAGCCTGCCTGCCCTA CTGCCCTAGCCTCCACATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 504} {0: 1, 1: 0, 2: 1, 3: 28, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!