ID: 1128046558_1128046564

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1128046558 1128046564
Species Human (GRCh38) Human (GRCh38)
Location 15:64623079-64623101 15:64623092-64623114
Sequence CCCTTCTCAACCTGCTTCTGCAG GCTTCTGCAGGGGAGCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 343} {0: 1, 1: 0, 2: 2, 3: 27, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!